View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11426_high_52 (Length: 241)
Name: NF11426_high_52
Description: NF11426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11426_high_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 44202564 - 44202326
Alignment:
| Q |
1 |
atataatggggaaaactaatagcagctgttat-----catttaatagttatgaaaatgctacattgtaccgaaacaaatttctaccgaatcatccgaatg |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44202564 |
atataatggggaaaactaatagcagctgttatgttatcatttaatagttatgaaaatgctacattgtaccgaaacaa-tttctaccgaatcatccgaatg |
44202466 |
T |
 |
| Q |
96 |
acttggcagtttacatggatttgattttatcgctgtacattttgacccaaaatcactttctgcccctcactgcattaacaggaatcactaacgcagcatt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44202465 |
acttggcagtttacatggatttgattttatcactgtacattttgacccaaaagaactttctgcccctcactgcattaacaggaatcactaacgcagcatt |
44202366 |
T |
 |
| Q |
196 |
gcctctggcgcctggcggtgaaggaaatactatcgctccc |
235 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44202365 |
gcctctggcacctggcggtgaaggaaatactatcgctccc |
44202326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 46
Target Start/End: Complemental strand, 44191248 - 44191215
Alignment:
| Q |
13 |
aaactaatagcagctgttatcatttaatagttat |
46 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
44191248 |
aaaccaatagcagctgttatcatttaatagttat |
44191215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University