View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11426_high_61 (Length: 207)
Name: NF11426_high_61
Description: NF11426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11426_high_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 12 - 187
Target Start/End: Complemental strand, 32377204 - 32377029
Alignment:
| Q |
12 |
gagagagatgaagaatcacaggttcaagttagagacaaaccctttgagaaaaaatacgcatttgtatctaaagatcaacaaggaggaattatagaaaata |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377204 |
gagatagatgaagaatcacaggttcaagttagagacaaacccttcgagaaaaaatacgcatttgtatctaaagatcaacaaggaggaattatagaaaata |
32377105 |
T |
 |
| Q |
112 |
gaccgaaatggagtggaggaatacttgacatttggaatgatctatcattatcatatctctcacttttctgcccttt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32377104 |
gaccgaaatggagtggaggaatacttgacatttggaatgatctatcattatcatatctctcacttttctgcccttt |
32377029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 12 - 187
Target Start/End: Complemental strand, 32365519 - 32365344
Alignment:
| Q |
12 |
gagagagatgaagaatcacaggttcaagttagagacaaaccctttgagaaaaaatacgcatttgtatctaaagatcaacaaggaggaattatagaaaata |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||| || ||||||||||| ||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32365519 |
gagatagatgaagaatcacaggttcaagttagagagaaaccattcgagaaaaaatatgcatttgcatctaaagatcaacaaggaggtattatagaaaata |
32365420 |
T |
 |
| Q |
112 |
gaccgaaatggagtggaggaatacttgacatttggaatgatctatcattatcatatctctcacttttctgcccttt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32365419 |
gaccgaaatggagtggaggaatacttgacatttggaatgatctatcattatcatatctctcacttttctgcccttt |
32365344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 105 - 146
Target Start/End: Complemental strand, 36122044 - 36122003
Alignment:
| Q |
105 |
gaaaatagaccgaaatggagtggaggaatacttgacatttgg |
146 |
Q |
| |
|
||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
36122044 |
gaaaatagaccaaagtggagtggtggaatacttgacatttgg |
36122003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University