View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11426_low_32 (Length: 319)

Name: NF11426_low_32
Description: NF11426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11426_low_32
NF11426_low_32
[»] chr7 (4 HSPs)
chr7 (18-309)||(7969261-7969552)
chr7 (18-229)||(37577632-37577841)
chr7 (53-122)||(32895222-32895287)
chr7 (261-301)||(37577563-37577603)
[»] chr5 (11 HSPs)
chr5 (141-304)||(25477764-25477924)
chr5 (20-227)||(32651194-32651398)
chr5 (19-227)||(32768424-32768629)
chr5 (141-228)||(32710668-32710755)
chr5 (141-227)||(32557359-32557445)
chr5 (53-156)||(32740594-32740694)
chr5 (129-208)||(32763443-32763522)
chr5 (261-304)||(32858859-32858902)
chr5 (18-186)||(25469920-25470085)
chr5 (261-303)||(32655694-32655736)
chr5 (259-304)||(25469805-25469850)
[»] chr1 (1 HSPs)
chr1 (150-228)||(17583916-17583994)


Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 309
Target Start/End: Original strand, 7969261 - 7969552
Alignment:
Q  18 attgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatc 117  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||    
T  7969261 attgtcttcatgacaagggttgccgacagtggcagatgatgaggtggatgattgcctgcttttggatttagtaattggtgatgatggcgcagtggtcatc 7969360  T
Q  118 tagtctccgatgaggcggctgacgaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaaga 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7969361 tagtctccgatgaggcggctgacgaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaaga 7969460  T
Q  218 tcagacgttgcaagtgtacttggtaatctttattcttttcgaaaatcttctccttcacattgactattgtgtctgaactcttaacccctatg 309  Q
    |||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  7969461 tcagacgttgcacgtgtacttggtaatctttattcttgtcgaaaatcttctccttcacattgcctattgtgtctgaactcttaacccctatg 7969552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 37577841 - 37577632
Alignment:
Q  18 attgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatc 117  Q
    ||||||||||||||||||||  || || ||||||||  |||||||||| | |||| ||||||||||| || ||||||| |  ||| |||| | |||||||    
T  37577841 attgtcttcatgacaagggtcaccaacggcggcagacaatgaggtggacggttgcatgctcttggatgtattaatcgggg--gattgtgcggaggtcatc 37577744  T
Q  118 tagtctccgatgaggcggctgacgaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaaga 217  Q
    || || || |||| ||||  |||||  | |||||||||| |||||||||||| | ||||||||| ||||||||| | ||||| || ||||| ||||||||    
T  37577743 taatcccccatgatgcggaggacgaatttgagggttgacttctcttggatgtggtaattggcaagggtcaggctattatctagttccttaccggcaaaga 37577644  T
Q  218 tcagacgttgca 229  Q
    ||||||||||||    
T  37577643 tcagacgttgca 37577632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 53 - 122
Target Start/End: Complemental strand, 32895287 - 32895222
Alignment:
Q  53 atgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtc 122  Q
    ||||| ||||||||| |||||||||||||||| ||||||| ||||||||    |||||||||||||||||    
T  32895287 atgataaggtggatggttgcctgctcttggatgtagtaat-ggtgatga---cgcagtggtcatctagtc 32895222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 261 - 301
Target Start/End: Complemental strand, 37577603 - 37577563
Alignment:
Q  261 aatcttctccttcacattgactattgtgtctgaactcttaa 301  Q
    ||||||||||||||||| | |||| ||||||||||||||||    
T  37577603 aatcttctccttcacatcggctatcgtgtctgaactcttaa 37577563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 11)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 141 - 304
Target Start/End: Complemental strand, 25477924 - 25477764
Alignment:
Q  141 gaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaagatcagacgttgcaagtgtacttgg 240  Q
    |||||||| ||||||| |||||||||||||| |||||||||||||| ||| ||| |||| |||||||| || ||| |||||||||||   ||  ||||||    
T  25477924 gaggtggatggttgacttctcttggatgttgtaattggcaatggtctggcagtcgtctagttgcttaccggaaaatatcagacgttgatcgttcacttgg 25477825  T
Q  241 taatctttattcttttcgaaaatcttctccttcacattgactattgtgtctgaactcttaaccc 304  Q
    ||  |||| | ||| || |||||||||||||||||| || |||| |||||||||||||||||||    
T  25477824 ta--cttt-tccttgtcaaaaatcttctccttcacactgtctatcgtgtctgaactcttaaccc 25477764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 227
Target Start/End: Original strand, 32651194 - 32651398
Alignment:
Q  20 tgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatcta 119  Q
    ||||||| ||| || |||||||||  || ||||||||||||||||| | ||| || ||||||||| ||||||||||    ||||||||||||||||||||    
T  32651194 tgtcttcgtgataacggttgccgatggcagcagatgatgaggtggacggttgacttctcttggatatagtaatcgg---cgatggtgcagtggtcatcta 32651290  T
Q  120 gtctccgatgaggcggctgacgaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaagatc 219  Q
    ||| |||||||  |||   | |||||| | ||||||| | ||||||||| || ||| ||||| | || ||| ||| |||| ||| ||||  |||||||||    
T  32651291 gtccccgatgacacggagaatgaggtgaatggttgacttatcttggatgatgtaatcggcaaggatccggccgtcctctagttgtttaccagcaaagatc 32651390  T
Q  220 agacgttg 227  Q
    | ||||||    
T  32651391 aaacgttg 32651398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 32768629 - 32768424
Alignment:
Q  19 ttgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatct 118  Q
    |||||||||||| ||||||  ||||| |||||| | ||||||||||| |  |||||||||||| |   ||||||| | ||||||| ||  ||| ||||||    
T  32768629 ttgtcttcatgataagggtccccgacggcggcaaacgatgaggtggacggctgcctgctcttgaaaacagtaatcagcgatgatg-tg--gtgatcatct 32768533  T
Q  119 agtctccgatgaggcggctgacgaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaagat 218  Q
    |||| ||  | |||||| |||||| ||| ||| ||||| |||||||||||||||||||||||| ||||  | ||||||||  |||| ||| |||||| ||    
T  32768532 agtccccagtaaggcggatgacgacgtgcaggattgacttctcttggatgttgcaattggcaagggtctcgttgtcatctcgttgcctaccggcaaatat 32768433  T
Q  219 cagacgttg 227  Q
    || ||||||    
T  32768432 caaacgttg 32768424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 141 - 228
Target Start/End: Complemental strand, 32710755 - 32710668
Alignment:
Q  141 gaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaagatcagacgttgc 228  Q
    ||||| |||||||||| |||||||||||||| ||||||||| |||| | | |||| ||| || |||||||||||||||||||| ||||    
T  32710755 gaggttgagggttgacttctcttggatgttgtaattggcaagggtctgacagtcagctagttccttactggcaaagatcagacattgc 32710668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 141 - 227
Target Start/End: Original strand, 32557359 - 32557445
Alignment:
Q  141 gaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaagatcagacgttg 227  Q
    |||||||||||||| | |||||||||||||| ||| ||||| |||  |||||||||||| | ||||| ||||||| |||||||||||    
T  32557359 gaggtggagggttgccttctcttggatgttgtaataggcaagggtatggctgtcatctagtagcttattggcaaacatcagacgttg 32557445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 53 - 156
Target Start/End: Complemental strand, 32740694 - 32740594
Alignment:
Q  53 atgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtctccgatgaggcggctgacgaggtggagggt 152  Q
    ||||| |||||||  ||||||  ||||||||| ||||||||||||||| || ||   |||||||||||||||| | |||||||  |||||||||||||||    
T  32740694 atgataaggtggacaattgccaactcttggatgtagtaatcggtgatggtgttg---tggtcatctagtctccaaggaggcggaggacgaggtggagggt 32740598  T
Q  153 tgac 156  Q
    ||||    
T  32740597 tgac 32740594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 129 - 208
Target Start/End: Complemental strand, 32763522 - 32763443
Alignment:
Q  129 gaggcggctgacgaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttac 208  Q
    ||||||| ||| |||||||| ||||||  |||||||||||||| ||||||||| ||| ||| |||| ||||| |||||||    
T  32763522 gaggcggatgaggaggtggatggttgaattctcttggatgttgtaattggcaagggtaaggttgtcctctaactgcttac 32763443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 261 - 304
Target Start/End: Complemental strand, 32858902 - 32858859
Alignment:
Q  261 aatcttctccttcacattgactattgtgtctgaactcttaaccc 304  Q
    |||| ||||||||||||||||||| |||||||||||||||||||    
T  32858902 aatcatctccttcacattgactatcgtgtctgaactcttaaccc 32858859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 186
Target Start/End: Complemental strand, 25470085 - 25469920
Alignment:
Q  18 attgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatc 117  Q
    ||||||||||||| |  ||| |||||  || || ||||||||||| |||| |||||||||||||||| ||||||||      ||||||   || ||| ||    
T  25470085 attgtcttcatgatacaggtcgccgatggcagcggatgatgaggttgatggttgcctgctcttggatgtagtaatc---accgatggtttggttgtcgtc 25469989  T
Q  118 tagtctccgatgaggcggctgacgaggtggagggttgacctctcttggatgttgcaattggcaatggtc 186  Q
    ||||| || ||||||||   |||||||  || || |||| |||||| ||||||||||||||||||||||    
T  25469988 tagtcgcccatgaggcgaaagacgaggaagatggctgacttctcttcgatgttgcaattggcaatggtc 25469920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 303
Target Start/End: Original strand, 32655694 - 32655736
Alignment:
Q  261 aatcttctccttcacattgactattgtgtctgaactcttaacc 303  Q
    |||||||| |||||||| || ||||||||||||||||||||||    
T  32655694 aatcttcttcttcacatcgagtattgtgtctgaactcttaacc 32655736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 304
Target Start/End: Complemental strand, 25469850 - 25469805
Alignment:
Q  259 aaaatcttctccttcacattgactattgtgtctgaactcttaaccc 304  Q
    |||||||||||||||||| ||  ||| |||||||||||||||||||    
T  25469850 aaaatcttctccttcacactgtatatcgtgtctgaactcttaaccc 25469805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 150 - 228
Target Start/End: Complemental strand, 17583994 - 17583916
Alignment:
Q  150 ggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaagatcagacgttgc 228  Q
    ||||||| |||||||||||||| ||| ||||| |||| || |||| |||| |||||||| | |||||||||||||||||    
T  17583994 ggttgacttctcttggatgttgtaatcggcaagggtccggttgtcctctagttgcttaccgtcaaagatcagacgttgc 17583916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University