View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11426_low_46 (Length: 250)
Name: NF11426_low_46
Description: NF11426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11426_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 12 - 184
Target Start/End: Complemental strand, 36173666 - 36173494
Alignment:
| Q |
12 |
atgaaatttgcaggaaaggtagtcacgttatatgaagtaatcctgttctttgtgcgtgtaacattttatgttgtatatttaatccaaacgcaattataaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36173666 |
atgaaatttgcaggaaaggtagtcacgttatatgaagtaatcctgttctttgtgcgtgtaacattttatgttgtatatttaatccaaacgcaattataaa |
36173567 |
T |
|
| Q |
112 |
attgttagtattgcaacaagtggtgttgtttatatggtgtctataaattgtgattcgtatcccgtctttgaca |
184 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36173566 |
attgttagtattgcagcaagtggtgttgtttatatggtgtctataaattgtgattcgtatcccgtctttgaca |
36173494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 198 - 250
Target Start/End: Complemental strand, 36173445 - 36173393
Alignment:
| Q |
198 |
gtaattctggaggaagtgatcactgtacaggcggattaaatcataacttatgt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36173445 |
gtaattctggaggaagtgatcactgtacaggcggattaaatcataacttatgt |
36173393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University