View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11426_low_51 (Length: 242)
Name: NF11426_low_51
Description: NF11426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11426_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 14560126 - 14559903
Alignment:
| Q |
1 |
taaaatatttatatatgacgatttactgatcatacacaattgattttattgtaaaattaatatatgatatgtgcttgatcttcttagtgttaatattggc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14560126 |
taaaatatttatatatgatgatttactgatcatacacaattgattttattgtaaaattaatatatgatatgtgcttgatcttcttagtgttaatattggc |
14560027 |
T |
 |
| Q |
101 |
tttcttgttgttgtagctttgacagaaatcttgcccaacctaaatctccttaagcttctttttacaccacttcttcctttcatacatgattagagcaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14560026 |
tttcttgttgttgtagctttgacagaaatcttgcccaacctaaatctccttaagcttctttttacaccacttcttcctttcatacatgattagagcaatt |
14559927 |
T |
 |
| Q |
201 |
gatttcatgtatggatgataacaa |
224 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
14559926 |
gatttcatgcatggatgataacaa |
14559903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University