View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11427_low_13 (Length: 336)
Name: NF11427_low_13
Description: NF11427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11427_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 20 - 331
Target Start/End: Complemental strand, 50527365 - 50527054
Alignment:
| Q |
20 |
ataatgtcaatttcagggatcttcacagcagcaattgcactttttactgatcttgatgttctcctcgatcttgtgtcaattggcacactctttgtatttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50527365 |
ataatgtcaatttcagggatcttcacagcagcaattgcactttttactgatcttgatgttctcctcgatcttgtgtcaattggcacactctttgtatttt |
50527266 |
T |
|
| Q |
120 |
acatggtggcaaatgctgtggtctatagacgttatgtggtggcagggacaacaaatccatggccaacagtgtcttttctcctctcattttccttcacttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50527265 |
acatggtggcaaatgctgtggtctatagacgttatgtggtggcagggacaacaaatccatggccaacagtgtcttttctcctctcattttccttcacttc |
50527166 |
T |
|
| Q |
220 |
catcatgttcacccttatttggaaatgtgtaccaacaggagtagcaaaagcagggatgttaagtgcttgtggtgtacttgctgtagtaatattgcaactt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50527165 |
catcatgttcacccttatttggaaatgtgtaccaacaggagtagcaaaagcagggatgttaagtgcctgtggtgtacttgctgtagtaatattgcaactt |
50527066 |
T |
|
| Q |
320 |
tttcatctcact |
331 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
50527065 |
tttcatttcact |
50527054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University