View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11427_low_14 (Length: 306)
Name: NF11427_low_14
Description: NF11427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11427_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 230 - 276
Target Start/End: Complemental strand, 37992291 - 37992245
Alignment:
| Q |
230 |
ttctcatctcgccgtcaccaccaccattctcgggcgccatctcttct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
37992291 |
ttctcatctcgccgtcaccaccaccattcttggccgccatctcttct |
37992245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University