View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11427_low_16 (Length: 281)
Name: NF11427_low_16
Description: NF11427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11427_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 22 - 271
Target Start/End: Original strand, 3035836 - 3036085
Alignment:
| Q |
22 |
tgcctaatatgatgtaaatatactatccagcacactatactgttaannnnnnnacacaattttgtttctgttgtaaatatatatgtacctaaactatgca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3035836 |
tgcctaatatgatgtaaatatactatccagcacactatactgttaatttttttacacaattttgtttctgttgtaaatatatatgtacctaaactatgca |
3035935 |
T |
 |
| Q |
122 |
tgattaacttaactagcatcatggttaatcatatgcatgtaatggtttaaggattcttgtctttgcaacctcatttgctggttgaacttacgtatgaaag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3035936 |
tgattaacttaactagcatcatggttaatcatatgcatgtaatggtttaaggattcttgtctttgcaacctcatttgctggttgaacttacgtatgaaag |
3036035 |
T |
 |
| Q |
222 |
cttcaacgcgtttattcaactcgtcttgactcaacgatggttcttctctc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3036036 |
cttcaacgcgtttattcaactcgtcttgactcaacgatggttcttttctc |
3036085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University