View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11428_high_16 (Length: 305)
Name: NF11428_high_16
Description: NF11428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11428_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 296
Target Start/End: Original strand, 43129176 - 43129471
Alignment:
| Q |
1 |
taccggcccatcatttcatctcattcagcctgatatctcatgcaaatttgcccctgttaacccgggctacgccgcttgtcttgataaaacccgaaaagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129176 |
taccggcccatcatttcatctcattcagcctgatatctcatgcaaatttgcccctgttaacccgggctacgccgcttgtcttgataaaacccgaaaagac |
43129275 |
T |
 |
| Q |
101 |
ttgatcgtcgcaaccgtggcttcttccctcattggttgcttcatcatgggtgcttttgctaatctcccattaggccttgctccaggtatgggctcaaacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129276 |
ttgatcgtcgcaaccgtggcttcttccctcattggttgcttcatcatgggtgcttttgctaatctcccattaggccttgctccaggtatgggctcaaacg |
43129375 |
T |
 |
| Q |
201 |
cttacttcgcttacaccgtcgtgggctttcacggttccggcactatctcctaccaaagcgcactcgcagcagttttcattgaaggattgttcttct |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43129376 |
cttacttcgcttacaccgtcgtgggctttcacggttccggcactatctcctaccaaagcgcactcgcagcagttttcattgaaggaatgttcttct |
43129471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University