View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11428_low_21 (Length: 250)
Name: NF11428_low_21
Description: NF11428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11428_low_21 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 7 - 250
Target Start/End: Complemental strand, 43129935 - 43129692
Alignment:
| Q |
7 |
gtgagatgaatcaccggcggcgctgttaggaaacgccgttactttcgtgtttcgaaaccacgaaattgctgttacgaaaacgattccgtatatcattgct |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129935 |
gtgagctgaatcaccggcggcgctgttaggaaacgccgttactttcgtgtttcgaaaccacgaaattgctgttacgaaaacgattccgtatatcattgct |
43129836 |
T |
 |
| Q |
107 |
cctttcacgttttttactaaacaatacgcgattataataaagcccaccaggcccaaccaaagtgttgggctttccattctatcacggagacaatatatat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43129835 |
cctttcacgttttttactaaacaatacgcgattataataaagcccaccaggcccaaccagagtgttgggctttccattctatcacggagacaaaatatat |
43129736 |
T |
 |
| Q |
207 |
caccagaaaccgttccacctgggagtaaactaacggttccgtta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129735 |
caccagaaaccgttccacctgggagtaaactaacggttccgtta |
43129692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University