View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11428_low_21 (Length: 250)

Name: NF11428_low_21
Description: NF11428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11428_low_21
NF11428_low_21
[»] chr3 (1 HSPs)
chr3 (7-250)||(43129692-43129935)


Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 7 - 250
Target Start/End: Complemental strand, 43129935 - 43129692
Alignment:
7 gtgagatgaatcaccggcggcgctgttaggaaacgccgttactttcgtgtttcgaaaccacgaaattgctgttacgaaaacgattccgtatatcattgct 106  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43129935 gtgagctgaatcaccggcggcgctgttaggaaacgccgttactttcgtgtttcgaaaccacgaaattgctgttacgaaaacgattccgtatatcattgct 43129836  T
107 cctttcacgttttttactaaacaatacgcgattataataaagcccaccaggcccaaccaaagtgttgggctttccattctatcacggagacaatatatat 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||    
43129835 cctttcacgttttttactaaacaatacgcgattataataaagcccaccaggcccaaccagagtgttgggctttccattctatcacggagacaaaatatat 43129736  T
207 caccagaaaccgttccacctgggagtaaactaacggttccgtta 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
43129735 caccagaaaccgttccacctgggagtaaactaacggttccgtta 43129692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University