View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11428_low_28 (Length: 226)
Name: NF11428_low_28
Description: NF11428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11428_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 4 - 138
Target Start/End: Original strand, 24413322 - 24413455
Alignment:
| Q |
4 |
agtgtcactgcttcctcctttccttcttctttgatgcttagctcagtcatcaatgcatctagctaagcagattgacaaacactcattgcaacaaaaatgt |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||| | ||||| |
|
|
| T |
24413322 |
agtgtcactgcttcttcctttccttcttcattgatgcttag-tcagtcatcaatgcatctagctaagcagcccgacaagcactcattgcaacgacaatgt |
24413420 |
T |
|
| Q |
104 |
attcagactcacaggttgatagagcaaccgctaat |
138 |
Q |
| |
|
||||||||||||| || |||||||||||| ||||| |
|
|
| T |
24413421 |
attcagactcacaagtagatagagcaaccactaat |
24413455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 185 - 223
Target Start/End: Original strand, 24413453 - 24413491
Alignment:
| Q |
185 |
aatatcctgcagtactcttcctatcatctttatcaccac |
223 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24413453 |
aatatcctgcagtactcttcttatcatctttatcaccac |
24413491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University