View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11429_low_2 (Length: 282)
Name: NF11429_low_2
Description: NF11429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11429_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 3 - 263
Target Start/End: Original strand, 21445148 - 21445396
Alignment:
| Q |
3 |
ttgaggaggagcagagaggattggatcagctgaactatgctttcctaatgcaggaatactaagagaacgttttcttaatttggctctaccatttgatgat |
102 |
Q |
| |
|
|||||||| | |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21445148 |
ttgaggagcaccagaaaggattggatcagctgaactatgctttcctaatgcaggaatactaagagaacgttttcttaatttggctctaccatttgatgat |
21445247 |
T |
|
| Q |
103 |
agtttcttctcactcttttcagcaagtaacgaaggataagcgcaaaagggttcttgagatgccactgctattggcaccgctattggcaccggctcacttc |
202 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21445248 |
agtttcttctcactcttttctgcaagtaacgaaggataagcgcaaaagggttcttgagatgccact------------gctattggcaccggctcacttc |
21445335 |
T |
|
| Q |
203 |
tagttctaaggaattggtcgagattttggcggtatttaatcccatggattttagctccaag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21445336 |
tagttctaaggaattggtcgagattttggcggtatttaatcccatggattttagctccaag |
21445396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University