View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1142_high_11 (Length: 228)
Name: NF1142_high_11
Description: NF1142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1142_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 56 - 223
Target Start/End: Complemental strand, 35090137 - 35089971
Alignment:
| Q |
56 |
tcccaaaataaaaatatcttaaagcactgattaacaataccaaaagtatgaagatatatatcaaacgtaaataaaggtaatttcatgtctgcttaaaaga |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35090137 |
tcccaaaataaaaatatcttaaagcactgattaacaataccaaaagtatgaagatatatatcaaacgtaaataaaggtaatttcatgt-tgcttaaaaga |
35090039 |
T |
 |
| Q |
156 |
aagtaaatgtactatgtactcataacacattaagatagctaaaaataagaagaagaaaagtaaaacat |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35090038 |
aagtaaatgtactgtgtactcataacacattaagatagctaaaaataagaagaagaaaagtaaaacat |
35089971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 2 - 36
Target Start/End: Complemental strand, 35091779 - 35091745
Alignment:
| Q |
2 |
cctaaaatcatctatgtttagttttctcttttctc |
36 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35091779 |
cctaaaatcatctatgtttagttttctcttttctc |
35091745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 63
Target Start/End: Complemental strand, 8160732 - 8160678
Alignment:
| Q |
9 |
tcatctatgtttagttttctcttttctcatacttaggtctctttgtttcccaaaa |
63 |
Q |
| |
|
|||||| | ||||||||||||||||||| | |||||| | ||||||||||||||| |
|
|
| T |
8160732 |
tcatctctatttagttttctcttttctcgtgcttaggcccctttgtttcccaaaa |
8160678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University