View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1142_high_8 (Length: 281)
Name: NF1142_high_8
Description: NF1142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1142_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 38 - 225
Target Start/End: Complemental strand, 20998532 - 20998345
Alignment:
| Q |
38 |
cagagaaacaaaaacggaacaggtttgtctttctcccagcaaacaaccgaactcggatcgaaactcgccggtttcttcttcagctgcggaaccttttcct |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20998532 |
cagagaaacaaaaacggaacaggtttgtctttctcccagcaaacaaccgaactcggatcgaaactcgccggtttcttcttcagctgcggaaccttttcct |
20998433 |
T |
 |
| Q |
138 |
tcaattcagcgactattcccttcgaagatgatgatgtgtttcggatcttgctcggcggttcttcatgaacagtttcttcgggtttttg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20998432 |
tcaattcagcgactattcccttcgaagatgatgatgtgtttcggatcttgctcggcggttcttcatgaacagtttcttcgggtttttg |
20998345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 39 - 225
Target Start/End: Complemental strand, 20988299 - 20988113
Alignment:
| Q |
39 |
agagaaacaaaaacggaacaggtttgtctttctcccagcaaacaaccgaactcggatcgaaactcgccggtttcttcttcagctgcggaaccttttcctt |
138 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||| |||||||| |
|
|
| T |
20988299 |
agagaaacaaaaacggcacaggtttgtttttctcccagcaaacaaccgaactcggatcgaaattctccggtttcttcttcagctccggaactttttcctt |
20988200 |
T |
 |
| Q |
139 |
caattcagcgactattcccttcgaagatgatgatgtgtttcggatcttgctcggcggttcttcatgaacagtttcttcgggtttttg |
225 |
Q |
| |
|
||||||||||||||| || || ||||| ||||| ||||| ||||||||||||| || ||||||||||| ||||||||||| ||||| |
|
|
| T |
20988199 |
caattcagcgactatcccgttggaagaagatgaagtgttgcggatcttgctcgatggatcttcatgaacggtttcttcgggattttg |
20988113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University