View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1142_low_11 (Length: 302)
Name: NF1142_low_11
Description: NF1142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1142_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 80 - 236
Target Start/End: Original strand, 45518242 - 45518398
Alignment:
| Q |
80 |
acaatcgcattcttgagttaaaagaatcatcattcatccgtaaccaaaaattgtgcaaatcagtttttgtgatatctgatttccattgcatgcatccccg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45518242 |
acaatcgcattcttgagttaaaagaatcatcattcatccgtaaccaaaaattgtgcaaatcagtttttgtgatatctgatttccattgcatgcatccccg |
45518341 |
T |
|
| Q |
180 |
tagtgcccttaacaattctctggccaactctggtgatgattgcatccctatccctat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45518342 |
tagtgcccttaacaattctctggccaactctggtgatgattgcatccctatccctat |
45518398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University