View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11430_high_10 (Length: 388)
Name: NF11430_high_10
Description: NF11430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11430_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 336
Target Start/End: Original strand, 2066552 - 2066887
Alignment:
| Q |
1 |
gatccaattttcacaggcaaacatcctcaaataattctgatatgcagtattatttcgcttaacgggcttccttcttaggaccattgtaaatcacaatcca |
100 |
Q |
| |
|
||||||||||||| || |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2066552 |
gatccaattttcatagacaaacatcctcaaaaaattctcatatgcagtattatttcgcttaacgggcttccttcttaggaccattgtaaatcacaatcca |
2066651 |
T |
 |
| Q |
101 |
acggtacgcacgacattttacccttgcgcatgctagacttcgccttgaaacaaaggcaaacaaatagaaagagaaaatgttgacgaaggaatgaatatgc |
200 |
Q |
| |
|
|||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2066652 |
acggcacgcacgacattttacacttgcgcacgctagacttcgccttgaaacaaaggcaaacaaatagaaagagaaaaagttgacgaaggaatgaatatgc |
2066751 |
T |
 |
| Q |
201 |
atgcatgcatgcatatgtttaaaaagctttccttgttttgcgtagcatcgaaataaaaaagaatgaaacattttgggtagatttatttttgttcaaattg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2066752 |
atgcatgcatgcatatgtttaaaaagctttccttgttttgcgtagcatcgaaataaaaaagaatgaaacatgttgggtagatttatttttgttcaaattg |
2066851 |
T |
 |
| Q |
301 |
gatagaaacatgttggatgggatctgcttgtgattc |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2066852 |
gatagaaacatgttggatgggatctgcttgcgattc |
2066887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University