View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11430_high_26 (Length: 228)
Name: NF11430_high_26
Description: NF11430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11430_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 29274014 - 29274238
Alignment:
| Q |
1 |
caacttcatcaaagccacgttagatactgaatagagttacttggccgatgctctttaaaatccatgttagggcttatcgtgttcttgatcatatcattcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29274014 |
caacttcatcaaagccacgttagatactgaatagggttacttggccgatgctctttaaaatccatgttagggcttatcgtgttcttgatcatacaattcc |
29274113 |
T |
 |
| Q |
101 |
tccttcaaagaatgataagaagtcgatttcatgtctttgatgt--ttgtgtttacagtggatttacggcactatctcttgcgatcctcccaacacaatca |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29274114 |
tccttcaaagaatgataagaagtcgatttcatgtctttgatgttgttgtgtttacagtggatttacggcactatctcttgcgatcttcccaacacaatca |
29274213 |
T |
 |
| Q |
199 |
ttgaacgtgattcaaccaccgaact |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
29274214 |
ttgaacgtgattcaaccaccgaact |
29274238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University