View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11430_low_15 (Length: 302)
Name: NF11430_low_15
Description: NF11430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11430_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 17 - 212
Target Start/End: Original strand, 39331238 - 39331432
Alignment:
| Q |
17 |
cttattacacattcgagaaccaaaatgattattatctcattccacctacgtaccatgcaaatggccattgcttgccacttcnnnnnnngtgtgtaaaacg |
116 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39331238 |
cttattacaaattcaagaatcaaaatgattattattccattccacgtacgtaccatgcaaatggccattgcttgccacttctttttt-gtgtgtaaaacg |
39331336 |
T |
|
| Q |
117 |
attaggaaaggtactcgtatactattgtttgtagggttgtaaaattggagtaattagaaaaaagattaatattatttggtcttcaattcaatgaca |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39331337 |
attaggaaaggtactcggatactattgtttggagggttgtaaaattggagtaattagaaaaaagattaatattatttggtcttcaattcaatgaca |
39331432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 230 - 297
Target Start/End: Original strand, 39331419 - 39331488
Alignment:
| Q |
230 |
tcaattcaatgacattggttaca--tgtttacagcttactcctagtagtagtatatcatttcatctcact |
297 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39331419 |
tcaattcaatgacattggttacacatgtttacagcttactcctagtagtagtatatcatttcatttcact |
39331488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University