View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11430_low_17 (Length: 283)
Name: NF11430_low_17
Description: NF11430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11430_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 11 - 157
Target Start/End: Original strand, 18935922 - 18936068
Alignment:
| Q |
11 |
gagatgaagatttcaatggtttctttggttcttactatgtctttcttgttcttttccattgttgtgggtgatcttggtttagggtacattccacacccac |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18935922 |
gagatgaaaatttcaatggtttctttggttggtactatgtctttcttgttcttttccattgttgtgggtgatcttggcttagggtacattccacacccac |
18936021 |
T |
|
| Q |
111 |
cacctttgccttctcacatagtcaaaatgttgattccctctccacta |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18936022 |
cacctttgccttctcacatagtcaaaatgttgattccctctccacta |
18936068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 154 - 267
Target Start/End: Original strand, 18936125 - 18936241
Alignment:
| Q |
154 |
actaactagcaaacattccaatttaaattttggaatgttaccaaaaggtgatcgtgttccaccatcgggacctagcaataaaacatctga---ctctcca |
250 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
18936125 |
actaactaacaaacattccaatttaaattttgaaatgttaccaaaaggtgatcgtgttccaccatcgggacctagcaataaaacatctgatggccctcca |
18936224 |
T |
|
| Q |
251 |
cctccaccacattttct |
267 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
18936225 |
cctccaccacattttct |
18936241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 21947535 - 21947499
Alignment:
| Q |
187 |
aatgttaccaaaaggtgatcgtgttccaccatcggga |
223 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21947535 |
aatgttaccaaaaggtgagcgtgttccaccatcggga |
21947499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University