View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11430_low_20 (Length: 248)
Name: NF11430_low_20
Description: NF11430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11430_low_20 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 25 - 248
Target Start/End: Original strand, 41153616 - 41153839
Alignment:
| Q |
25 |
ccttgttactttacatctagtgttgttcttctctcttcaagtcnnnnnnnntggacaagaaactatttctcttgttcatattttcagcagtattggtttg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41153616 |
ccttgttactttacatctagtgttgttcttctctcttcaagtcaaaaaaaatggacaagaaactatttctcttgttcatattttcagcagtattggtttg |
41153715 |
T |
 |
| Q |
125 |
tattgaagctgaaccattggaagataaacaagctttacttgatttccttcacaacataaaccactctccacacttcaattgggatgagaattcttctgta |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41153716 |
tattgaagctgaaccattggaagataaacaagctttacttgatttccttcacaacataaaccactctccacacttcaattgggatgagaattcttctgta |
41153815 |
T |
 |
| Q |
225 |
tgccaaacatggagaggagttacc |
248 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
41153816 |
tgccaaacatggagaggggttacc |
41153839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 115 - 191
Target Start/End: Complemental strand, 9838468 - 9838392
Alignment:
| Q |
115 |
tattggtttgtattgaagctgaaccattggaagataaacaagctttacttgatttccttcacaacataaaccactct |
191 |
Q |
| |
|
|||| |||||| ||| |||||||||| | ||||||||||||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
9838468 |
tatttgtttgtgttggagctgaaccagcagcagataaacaagctttgcttgatttccttcacaaaatgaaccactct |
9838392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University