View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11430_low_9 (Length: 416)
Name: NF11430_low_9
Description: NF11430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11430_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 1e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 16 - 154
Target Start/End: Complemental strand, 18343047 - 18342909
Alignment:
| Q |
16 |
aattacatccacctaaacgaaaacatcataaaattcacaatccaaggtataactagtacagccaacaagacaaactaagcttcgattccggcaaagagcg |
115 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18343047 |
aattacatgcatctaaacgaaaacatcataaaattcacaatccaaggtataactagtacagccaacgagacaaactaagcttcgattccggcaaagagcg |
18342948 |
T |
|
| Q |
116 |
gtggtcatgttttgaagagagaactccgtaaacattgag |
154 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
18342947 |
gtggtcatgttttggagagagaactcggtaaacattgag |
18342909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 199 - 309
Target Start/End: Complemental strand, 26616524 - 26616412
Alignment:
| Q |
199 |
acatgtaactgcaatcaaacacactgtaaatttcatgtttgacagaggttgtgttgttgcgtttcggcggaagaggatgcgtgaatggt--ttggcgatg |
296 |
Q |
| |
|
||||||||||| |||||||||||||| |||||| | ||||||| |||||||||||||| ||| || ||| |||||||||| ||| || ||||||||| |
|
|
| T |
26616524 |
acatgtaactgaaatcaaacacactgcgaatttcgtttttgacaaaggttgtgttgttgggttatggtggaggaggatgcgtcaatcgttattggcgatg |
26616425 |
T |
|
| Q |
297 |
gtggtgcggcgtt |
309 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
26616424 |
gtggtgcgtcgtt |
26616412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 199 - 309
Target Start/End: Complemental strand, 26722452 - 26722340
Alignment:
| Q |
199 |
acatgtaactgcaatcaaacacactgtaaatttcatgtttgacagaggttgtgttgttgcgtttcggcggaagaggatgcgtgaatggt--ttggcgatg |
296 |
Q |
| |
|
||||||||||| |||||||||||||| |||||| | ||||||| |||||||||||||| ||| || ||| |||||||||| ||| || ||||||||| |
|
|
| T |
26722452 |
acatgtaactgaaatcaaacacactgcgaatttcgtttttgacaaaggttgtgttgttgggttatggtggaggaggatgcgtcaatcgttattggcgatg |
26722353 |
T |
|
| Q |
297 |
gtggtgcggcgtt |
309 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
26722352 |
gtggtgcgtcgtt |
26722340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University