View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11431_high_2 (Length: 263)
Name: NF11431_high_2
Description: NF11431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11431_high_2 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 7 - 263
Target Start/End: Original strand, 32014785 - 32015041
Alignment:
| Q |
7 |
ggacgttggactcaatttacacaagctctgaataaaaaatacagagatcagggaaactatgtttaatattttgcaggttttgagtcaaagacatcaagca |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32014785 |
ggactttggactcaatttacacaagctctgaatacaaaatacagagatcagggaaactatgtttaatattttgctggttttgagtcaaagacatcaagca |
32014884 |
T |
 |
| Q |
107 |
atcttcttctgtactatggtccatttgtaagcaatgaaatcatctcattttgagaaacaagcacatgttttgtcttgctgtttgtgatcgaggaatgaat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32014885 |
atcttcttctgtactatggtccatttgtaagcaatgaaatcatctcattttaagaaacaagcacttgttttgtcttgctgtttgtgatcgaggaatgaat |
32014984 |
T |
 |
| Q |
207 |
tttctatttagatggcaaaatgctttggaaatccgcagcagagaagttgtgcagcat |
263 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32014985 |
tttctatttagatggcaaaatgcttaggaaatccgcagcagagaagttgtgcagcat |
32015041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University