View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11433_high_23 (Length: 297)
Name: NF11433_high_23
Description: NF11433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11433_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 42 - 286
Target Start/End: Complemental strand, 35364141 - 35363897
Alignment:
| Q |
42 |
ccccgagaaaatccacccagccattttcccgagaaaatcaccaacacagcacaagaacaacaacaatcaatcgatgatctacttaccgtgattccactcg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364141 |
ccccgagaaaatccacccagccattttcccgagaaaatcaccaacacagcacaagaacaacaacaatcaatcgatgatctacttaccgtgattccactcg |
35364042 |
T |
|
| Q |
142 |
aggacgaagacgatgatgaggtcgacccctcatggaacaaaatctaaatctcacattgctcacaacttccactgatccagatgatgttcgactgattgag |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364041 |
aggacgaagacgatgatgaggtcgacccctcatggaacaaaatctaaatctcacattgctcacaacttccactgatccagatgatgttcgactgattgag |
35363942 |
T |
|
| Q |
242 |
tgggaagattttgagcatgatcttgctaggttatcgagtctctct |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35363941 |
tgggaagattttgagcatgatcttgctaggttatcgagtctctct |
35363897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 62 - 121
Target Start/End: Complemental strand, 35364815 - 35364756
Alignment:
| Q |
62 |
ccattttcccgagaaaatcaccaacacagcacaagaacaacaacaatcaatcgatgatct |
121 |
Q |
| |
|
|||| |||| |||||||||| ||||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
35364815 |
ccatattcctgagaaaatcatcaacacaccacaagaacaacaagaatcaattgatgatct |
35364756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University