View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11433_high_29 (Length: 258)
Name: NF11433_high_29
Description: NF11433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11433_high_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 1711516 - 1711291
Alignment:
| Q |
1 |
tctcactctgatgttcaggtcatttcatcgcatattttt-gtgaagacaatgggtgcgcagacaagcttgctaactatgatcactctattcagggttctt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
1711516 |
tctcactctgatgttcaggtcatttcatcgcatattttttgtgaagacaataggtgcgcagacaagcttgctaactatggtcactctattcaaggttctt |
1711417 |
T |
 |
| Q |
100 |
ggtggtccactaacttacccaattttctcagggatgccttttttagggaccattttgaattgcagacgtatcgtcttccttagattttcttgttatgttt |
199 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
1711416 |
ggtggtcaactaacttacccaattttcttagggatgccttttttagggaccattttggattgcagacgtatcgtcttccttag-------------gttt |
1711330 |
T |
 |
| Q |
200 |
tcttttcttttgctttgagggtcagacctagtctccccc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1711329 |
tcttttcttttgctttgagggtcagacctagtctccccc |
1711291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 80 - 190
Target Start/End: Complemental strand, 19425070 - 19424960
Alignment:
| Q |
80 |
tcactctattcagggttcttggtggtccactaacttacccaattttctcagggatgccttttttagggaccattttgaattgcagacgtatcgtcttcct |
179 |
Q |
| |
|
||||||| |||||| |||||||||||| |||| |||||| |||| || ||||| | |||||||||||||| ||||| ||||| | ||||||| ||||| |
|
|
| T |
19425070 |
tcactctgttcaggattcttggtggtcaactagcttacctgatttccttagggaggacttttttagggaccgttttggattgcccatgtatcgttttcct |
19424971 |
T |
 |
| Q |
180 |
tagattttctt |
190 |
Q |
| |
|
||| ||||||| |
|
|
| T |
19424970 |
tagcttttctt |
19424960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University