View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11433_high_36 (Length: 247)
Name: NF11433_high_36
Description: NF11433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11433_high_36 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 35364505 - 35364276
Alignment:
| Q |
18 |
agtccaacaaatcatgaatggctccaatgagtatatgtaccctatgaatcttagcactgtcctggccatggatcccatggtttgattcatacattgtact |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35364505 |
agtccaacaaatcttgaatggctccaatgagtatatgtaccctatgaatcttagcactgttctggccatggatcccatggtttgattcatgcattgtact |
35364406 |
T |
|
| Q |
118 |
gttagttttctagatatttctctgagggattaattaagttacaatatgtctactattatgtgttaccatatcttatctcttcacttctcttatctcttat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35364405 |
attagttttctagatatttctctgagggattaattaagttacaatatgtctactagtatgtgttaccatatcttatctcttctcttctcttatctcttat |
35364306 |
T |
|
| Q |
218 |
taataaagcttattaggttaagcgattgct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35364305 |
taataaagcttattaggttaagcgattgct |
35364276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 22 - 147
Target Start/End: Complemental strand, 35376265 - 35376140
Alignment:
| Q |
22 |
caacaaatcatgaatggctccaatgagtatatgtaccctatgaatcttagcactgtcctggccatggatcccatggtttgattcatacattgtactgtta |
121 |
Q |
| |
|
||||| ||| ||| ||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||||||||||| ||||| ||| ||| |
|
|
| T |
35376265 |
caacagatcttgactggctccaatgagtatatgtaccctatgaatctaagcactgttctcgccatggatcccatagtttgattcatgcattgcactatta |
35376166 |
T |
|
| Q |
122 |
gttttctagatatttctctgagggat |
147 |
Q |
| |
|
||||| |||| |||||||| |||||| |
|
|
| T |
35376165 |
gttttttagacatttctctcagggat |
35376140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 48 - 105
Target Start/End: Complemental strand, 35357684 - 35357627
Alignment:
| Q |
48 |
gtatatgtaccctatgaatcttagcactgtcctggccatggatcccatggtttgattc |
105 |
Q |
| |
|
||||||| |||||||||||||||||||||| || ||||||||| |||||||||||||| |
|
|
| T |
35357684 |
gtatatgaaccctatgaatcttagcactgttctcgccatggattccatggtttgattc |
35357627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University