View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11433_high_42 (Length: 229)
Name: NF11433_high_42
Description: NF11433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11433_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 7 - 198
Target Start/End: Complemental strand, 38513312 - 38513127
Alignment:
| Q |
7 |
aaaaatgcatgttaataatcttttttgtgcttttctttacagatacccaactcattttgacctttcattatgttaaacataagtagcagcagtagtagta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38513312 |
aaaaatgcatgttaataatcttttttgtgcttttcattacagatacccaactcattttgacctttcattatgttaaacataagtagcagcagtagtagta |
38513213 |
T |
 |
| Q |
107 |
gatgtgggttattgaaataaattgttacataagcagataataattcatgttaatgttaatattccatcaatttttcttgttttgggttaatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38513212 |
gatgtgggttattgaaataaattgttacataggcagataataattcatgt------taatattccatcaatttttcttgttttgggttaatt |
38513127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University