View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11433_low_20 (Length: 387)
Name: NF11433_low_20
Description: NF11433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11433_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 274 - 380
Target Start/End: Original strand, 26324471 - 26324576
Alignment:
| Q |
274 |
atcacgggtgaaaaaatatcataaggacgactcaccgttcgtctcctttccaaaaatccttttgttttggacctttaggcccttcccttggaccccaatt |
373 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26324471 |
atcacgggtgaaaaac-atcataagaacgactcaccgttcgtctcctttccaaaaatccttttgttttggacctttaggcccttcccttggaccccaatt |
26324569 |
T |
|
| Q |
374 |
catctca |
380 |
Q |
| |
|
||||||| |
|
|
| T |
26324570 |
catctca |
26324576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 191 - 228
Target Start/End: Original strand, 26324322 - 26324359
Alignment:
| Q |
191 |
attattacaaggcctaattgagatataaaatttctacc |
228 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26324322 |
attattacaaagcctaattgagatataaaatttctacc |
26324359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University