View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11433_low_31 (Length: 258)
Name: NF11433_low_31
Description: NF11433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11433_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 19 - 252
Target Start/End: Complemental strand, 42690312 - 42690069
Alignment:
| Q |
19 |
atgatcatgtctttcacgtttacttgctgctgctaatcattgaaactgaaattatgtttatctctatttttcttgtgttaatcctctgttctcttgttct |
118 |
Q |
| |
|
||||||||||||||||||||| |||||| | ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42690312 |
atgatcatgtctttcacgtttgcttgctatt---aatcattcaaactgaaattatgtttatctctatttttcttgtgttaatcctctgttctcttgttct |
42690216 |
T |
|
| Q |
119 |
cagctccttgtaatacaaatttcactcaccaaaacttaaattattatgtcaaattctcattgcttgtgctt------------gtgcccaaaagccaggt |
206 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
42690215 |
gagctccttgtaatacaaatttcactgaccaaaacttaaattattatgtcaaattctcattgcttgtgcttgtgcttgtgcttgtgcccaaaaggcaggt |
42690116 |
T |
|
| Q |
207 |
gttgagctgtgtgacaaagtaagag-ttttttgaaggtctctgcttc |
252 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42690115 |
gttgagctgtgtgacaaagtaagagtttttttgaaggtctctgcttc |
42690069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University