View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11433_low_44 (Length: 244)
Name: NF11433_low_44
Description: NF11433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11433_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 16 - 169
Target Start/End: Original strand, 48252504 - 48252657
Alignment:
| Q |
16 |
atgaatgataataaggagtttaaaagtttgataatatttcagtataacactaattgtatgtttggtttggcttctagatagatgtgagtttgatttcacc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48252504 |
atgaatgataataaggagtttaaaagtttgataatatttcagtataacactaattgtatgtttggtttggcttctagatagatgtgagtttgatttcacc |
48252603 |
T |
 |
| Q |
116 |
gcaaaaacagagaaatattaaatgcatgttaggatttgcagtgatactataaga |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48252604 |
gcaaaaacagagaaatattaaatgcatgttaggatttgcagtgatactataaga |
48252657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 165 - 226
Target Start/End: Original strand, 48253013 - 48253074
Alignment:
| Q |
165 |
taagaataagagtgaaccatcacaatttatttctacaaaaactacatctgtatgtttggttt |
226 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48253013 |
taagaatcagagtgaaccatcacaatttatttctacaaaaactacatttgtatgtttggttt |
48253074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University