View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11433_low_47 (Length: 222)
Name: NF11433_low_47
Description: NF11433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11433_low_47 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 6769411 - 6769615
Alignment:
| Q |
1 |
aaataatatatcaaatatactgggagtgcgacaagtcttaggcacaggaaagtatctaggggtcccttcaatgattggcagaagcaagaattctactttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6769411 |
aaataatatatcaaatatactgggagtgcgacaagtcttaggcacaggaaagtatctaggggtcccttcaatgattggcagaagcaagaattctactttc |
6769510 |
T |
|
| Q |
101 |
aaatttataaaaaatcacatttggaacaaaattaactcttggagtagtaggtgcctctatcaagcagaaagagaagttttaatcaagtccgttctacatt |
200 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6769511 |
aaatttataaaagatcgcatttggaacaaaattaactcttggagtagtaggtgcctctatcaagcagaaagagaagttttaatcaagtccgttctacatt |
6769610 |
T |
|
| Q |
201 |
ctatt |
205 |
Q |
| |
|
||||| |
|
|
| T |
6769611 |
ctatt |
6769615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 104 - 153
Target Start/End: Complemental strand, 24269510 - 24269461
Alignment:
| Q |
104 |
tttataaaaaatcacatttggaacaaaattaactcttggagtagtaggtg |
153 |
Q |
| |
|
|||||||| ||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
24269510 |
tttataaaggatcacatttggaataaaatcaactcttggagcagtaggtg |
24269461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University