View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11434_high_13 (Length: 239)
Name: NF11434_high_13
Description: NF11434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11434_high_13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 34641805 - 34642026
Alignment:
| Q |
18 |
atttatactatccatatgtagttaaaaatatacaatccatatgtagttaaaaataatattctttttccttccaataatagtgggcatccccagatgcttg |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34641805 |
atttataccatccatatgtagttaaaaatatacaatccatatgtagttaaaaataatcttctttttccttccaatgatagtgggcatacccagatgcttg |
34641904 |
T |
|
| Q |
118 |
cctgaacccacccttgtttcttgaaaaattatttgtatttgtgtcttcatttgagtactagtattttttattg-aataaatctctaatttttgcatattg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34641905 |
cctgaacccacccttgtttcttgaaaaattatttgtatttgtgtcttcatttgagtactagta-tttttattgaaataaatctctaatttttgcatattg |
34642003 |
T |
|
| Q |
217 |
atagcttaaccagacaattgctc |
239 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
34642004 |
atagcttaacctgacaattgctc |
34642026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 118
Target Start/End: Complemental strand, 44250569 - 44250509
Alignment:
| Q |
58 |
atgtagttaaaaataatattctttttccttccaataatagtgggcatccccagatgcttgc |
118 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||| ||||| ||||| || ||||| |
|
|
| T |
44250569 |
atgtagttaaaaatagccttctttttccttccaatgatagagggcaaccccaaatacttgc |
44250509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University