View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11434_high_14 (Length: 238)
Name: NF11434_high_14
Description: NF11434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11434_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 43020774 - 43020568
Alignment:
| Q |
15 |
aaaaagaacctaaaaagtttattcttgtcttctatttctctattcaatattccattgtctttaataattattcccttcagaaactacctatgaagttacc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43020774 |
aaaaagaacctaaaaagtttattcttgtcttctatttctctattcaatattccattgtctttaatagttattcccttcagaaactacctatgaagttacc |
43020675 |
T |
 |
| Q |
115 |
ccctcccccgtttatcttgattttttgctttattgcatgcatgtcctttgagagaaaaataaagcattaataacatgttacatgtccgtcaaaaatacta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43020674 |
ccctcccccgtttatcttgattttttgctttattgcatgcatgtcctttgagagaaaaataaagcattaataacatgttacatgtccgtcaaaaatacta |
43020575 |
T |
 |
| Q |
215 |
tacaata |
221 |
Q |
| |
|
||||||| |
|
|
| T |
43020574 |
tacaata |
43020568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University