View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11434_low_14 (Length: 261)
Name: NF11434_low_14
Description: NF11434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11434_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 12157668 - 12157901
Alignment:
| Q |
18 |
atgctagcttctaaagcagcaacttcataaacaatctctcaagtttacatctcttaatgtcttttaaagtaaaaacaagcaaagaattgacagaagggcc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12157668 |
atgctagcttctaaagcagcaacttcataaacaatctctcaagtttatatctcttaatgtcttttaaagtaaaaacaagcaaagaattgacagaagggcc |
12157767 |
T |
 |
| Q |
118 |
ataaatcagcaaagatgatttccaagtagataatttcagcttgattttgttagcaataggttagacaatnnnnnnnttttggtctacctttgaaaattgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12157768 |
ataaatcagcaaagatgatttccaagcagataatttcagcttggttttgttagcaataggttagacaataaacaaattttggtctacctttgaaaattgg |
12157867 |
T |
 |
| Q |
218 |
aactccaaagtaaatgaaaggcaaggagcctatg |
251 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
12157868 |
aactccaaagtaaatgaaaggcagggagcctatg |
12157901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University