View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11436_high_47 (Length: 269)
Name: NF11436_high_47
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11436_high_47 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 133 - 269
Target Start/End: Complemental strand, 31549415 - 31549279
Alignment:
| Q |
133 |
ctttcctcctctaaccacctgtcctctaaccactgtacaagttatattaccagaactcatgtcattcgaaaataataattaccagaactcaaatgtcacc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31549415 |
ctttcctcctctaaccacctgtcctctaaccactgtacaagttatattaccagaactcatgtcattcgaaaataataattaccggaactcaaatgtcacc |
31549316 |
T |
 |
| Q |
233 |
atgatttggtgttaagaatttctaataatgaatgaat |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31549315 |
atgatttggtgttaagaatttctaataatgaacgaat |
31549279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University