View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11436_high_54 (Length: 245)

Name: NF11436_high_54
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11436_high_54
NF11436_high_54
[»] chr8 (1 HSPs)
chr8 (1-141)||(33825432-33825572)


Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 33825432 - 33825572
Alignment:
1 tactagattactttataaaagaaatagtaaagctggcgtgggatacacttctttggtccactaaaaactttagggtttaatatgtttttccatatgatct 100  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
33825432 tactagattactttataaaagaaagagtaaagctggcgtgggatacacttatttggtccactaaaaactttagggtttaatatgtttttccatatgatct 33825531  T
101 aactaaactaattaattatttcttttaatctcttcctttta 141  Q
    |||||||||||||||||||||||||||||||||||||||||    
33825532 aactaaactaattaattatttcttttaatctcttcctttta 33825572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University