View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11436_high_60 (Length: 231)
Name: NF11436_high_60
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11436_high_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 7830014 - 7830210
Alignment:
| Q |
17 |
caaaggtatgtggcaatcattatgcacttgaggctaatgagaagagacgtgtttgagtttaggtgattgtnnnnnnntagagatatcttagtatcattac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7830014 |
caaaggtatgtggcaatcattatgcacttgaggctaatgagaagagacgtgtttgagtttaggtgattgtaaaaaaatagagatatcttagtatcattag |
7830113 |
T |
 |
| Q |
117 |
aatatcaagctttccactctggattatgcctaataaggatatctattattgcattctagttggtgtaagaaatttgttctgattctataataagaag |
213 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7830114 |
aatatcaagctttccactcaggattatggctaataaggatatctattattgcattctagttggtgtaagaaatttgttctgattctataataagaag |
7830210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University