View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11436_high_62 (Length: 223)

Name: NF11436_high_62
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11436_high_62
NF11436_high_62
[»] chr5 (1 HSPs)
chr5 (93-145)||(35673149-35673201)


Alignment Details
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 93 - 145
Target Start/End: Original strand, 35673149 - 35673201
Alignment:
93 ctctcaacttccaccgctgctgatgcactctcccgcctcctccaccgtctccc 145  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
35673149 ctctcaacttccaccgctgctgatgcactctcccgcctcctccaccgtctccc 35673201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University