View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11436_low_20 (Length: 463)
Name: NF11436_low_20
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11436_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 4e-36; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 376 - 453
Target Start/End: Original strand, 9624916 - 9624993
Alignment:
| Q |
376 |
gagtactaaaaaatatgcagcaactgcagcttgaacggtctcttttgttttgcttctttagaatgaatctatcctttg |
453 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9624916 |
gagtactaaaaaatatgcagcaactgcagcttgaacggtctcttttgttttgcttctttagaatgaatctatcctttg |
9624993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 394 - 453
Target Start/End: Original strand, 9621183 - 9621243
Alignment:
| Q |
394 |
agcaactgc-agcttgaacggtctcttttgttttgcttctttagaatgaatctatcctttg |
453 |
Q |
| |
|
||||||||| ||| |||||||||| ||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
9621183 |
agcaactgccagcctgaacggtcttttttgttttgcttctttagaatggatctgtcctttg |
9621243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 383 - 443
Target Start/End: Original strand, 9622905 - 9622966
Alignment:
| Q |
383 |
aaaaaatatgcagcaactg-cagcttgaacggtctcttttgttttgcttctttagaatgaat |
443 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||| |||||||||| ||||| |
|
|
| T |
9622905 |
aaaaaatatgatgcaactgtcagcttgaacggtcttttttgtttttcttctttagactgaat |
9622966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 196 - 232
Target Start/End: Complemental strand, 9217999 - 9217963
Alignment:
| Q |
196 |
ttgtaatctcggttgcaaaatatggaagctcaatttt |
232 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9217999 |
ttgtaatctcggttgcaaaatatggcagctcaatttt |
9217963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 129 - 165
Target Start/End: Original strand, 9629051 - 9629087
Alignment:
| Q |
129 |
agagactaacctgcactagatgtgcatttgttagaga |
165 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9629051 |
agagactaacctgcactagatgtgcacttgttagaga |
9629087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University