View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11436_low_40 (Length: 311)

Name: NF11436_low_40
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11436_low_40
NF11436_low_40
[»] chr3 (2 HSPs)
chr3 (45-204)||(1411027-1411185)
chr3 (238-296)||(1411220-1411278)


Alignment Details
Target: chr3 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 45 - 204
Target Start/End: Original strand, 1411027 - 1411185
Alignment:
45 tttaatctggagtgtcgatgctacatataacatacaacataaacagttaaataaaggaaaagggttttcaactttcaagcttcaacttcaaataattgaa 144  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||| ||||||  ||||||||||||||||||||    
1411027 tttaatctggagcgtcgatgctacatataacatacaacataaacagttaaataaaggacaatggttt-caattttcaactttcaacttcaaataattgaa 1411125  T
145 ttcctgaacttgatgaacacaaagcactcagaaaagaagggtaggtagattcagaagcct 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1411126 ttcctgaacttgatgaacacaaagcactcagaaaagaagggtaggtagattcagaagcct 1411185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 238 - 296
Target Start/End: Original strand, 1411220 - 1411278
Alignment:
238 taactaccttaacagaattttaactaacaaaacaaacataccaggtttgaaattattga 296  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1411220 taactaccttaacagaattttaactaacaaaacaaacataccaggtttgaaattattga 1411278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University