View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11436_low_46 (Length: 270)
Name: NF11436_low_46
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11436_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 2630918 - 2630656
Alignment:
| Q |
1 |
atggagtagggttcttgtctgtgcggtcttgattgagagagaagggaatttaaaagtataaacgttctgcacgtgcccaacgatataagctgagacttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| | |
|
|
| T |
2630918 |
atggagtagggttcttgtctgtgcggtcttgattgagagagaagggaatttaaaagtataaacgttctgcacgtgcccaacgatataggctgaggcttag |
2630819 |
T |
 |
| Q |
101 |
aacataannnnnnnnnactcaatcttttacatttcaagcagtgagatatataatacataccaattaattttgggaaaattctcaacaaaggaaaaggaaa |
200 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2630818 |
aacataaattttttttactcaattttttacatttcaagcagtgagatatataatagataccaattaattttaggaaaattctcaacaaaggaaaaggaaa |
2630719 |
T |
 |
| Q |
201 |
cagcattgatttctgatttattttattaactagctataaaaaacgaaacagctacctttgctt |
263 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2630718 |
cagcattgatttctgatttattttatgaactagctataaaaaacgaaacagctagctttgctt |
2630656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University