View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11436_low_54 (Length: 245)
Name: NF11436_low_54
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11436_low_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 33825432 - 33825572
Alignment:
| Q |
1 |
tactagattactttataaaagaaatagtaaagctggcgtgggatacacttctttggtccactaaaaactttagggtttaatatgtttttccatatgatct |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33825432 |
tactagattactttataaaagaaagagtaaagctggcgtgggatacacttatttggtccactaaaaactttagggtttaatatgtttttccatatgatct |
33825531 |
T |
 |
| Q |
101 |
aactaaactaattaattatttcttttaatctcttcctttta |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33825532 |
aactaaactaattaattatttcttttaatctcttcctttta |
33825572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University