View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11436_low_56 (Length: 242)
Name: NF11436_low_56
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11436_low_56 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 242
Target Start/End: Complemental strand, 9625317 - 9625089
Alignment:
| Q |
12 |
catcttctatcttagaaaatatgaccctaacatttctcttaatttcctttatataaagttatttcttgaactggcttaaatgtattacttgaactagctt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9625317 |
catcttctatcttagaaaatatgaccctaacatttctcttattttcctttatata--gttatttcttgaactggcttaaaagtattacttgaactagctt |
9625220 |
T |
|
| Q |
112 |
aaaacatgatgatagccatgttaacgcatagatctgtgaccttttgaccttaattcacattcacatgactatttcaaacatgcgttaagccaagttcaag |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9625219 |
aaaacatgatgatagccatgttaaagcatagatctgtgaccttttgaccttaattcacattcacatgactatttcaaacatgcgttaagccaagttcaag |
9625120 |
T |
|
| Q |
212 |
taacaagtaaaagtgcggatgaactttaact |
242 |
Q |
| |
|
||||||||||||| | |||||||||||||| |
|
|
| T |
9625119 |
taacaagtaaaagcgtagatgaactttaact |
9625089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University