View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11436_low_57 (Length: 241)
Name: NF11436_low_57
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11436_low_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 63 - 195
Target Start/End: Original strand, 9188673 - 9188811
Alignment:
| Q |
63 |
aacatctatatctatctatata---ataaacaataaacaaa-tgacttgcaaaatttctcaagaacac--atgtcatctctcttttttaatgaacattta |
156 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
9188673 |
aacatctatatctatctatatagtaataaacaataaaaaaaatgacttgcaaaatttctcaagaacacacatgtcatctttcttttttaatgaacattta |
9188772 |
T |
|
| Q |
157 |
tgtctacttcacctcataaaaactctaatcatgactaca |
195 |
Q |
| |
|
|| |||||||||||||||||| |||| ||| ||||||| |
|
|
| T |
9188773 |
tgaatacttcacctcataaaaattctattcacgactaca |
9188811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 189 - 226
Target Start/End: Original strand, 9188838 - 9188875
Alignment:
| Q |
189 |
gactacattctgaattgaaatgaattaacactaatgat |
226 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9188838 |
gactacagtctgaattgaaatgaattaacactaatgat |
9188875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 92 - 178
Target Start/End: Original strand, 15616670 - 15616756
Alignment:
| Q |
92 |
ataaacaaatgacttgcaaaatttctcaagaacacatgtcatctctcttttttaatgaacatttatgtctacttcacctcataaaaa |
178 |
Q |
| |
|
||||| ||||| |||||||||||||||||| | ||||| | |||||||| ||| || |||| | |||||||||||||| |||||| |
|
|
| T |
15616670 |
ataaataaatggcttgcaaaatttctcaagtatacatgactcttctcttttctaaagatcattaaagtctacttcacctcgtaaaaa |
15616756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University