View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11436_low_59 (Length: 236)
Name: NF11436_low_59
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11436_low_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 30361115 - 30361332
Alignment:
| Q |
1 |
tgaaatggctttggttttgtgcagtgttttggttctggctttggtgggatctgcaaattatcagtagatttaataataatgtcgtaaaaaattgaagtag |
100 |
Q |
| |
|
||||| |||| |||||||||||| ||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||| ||||||||| |||| |
|
|
| T |
30361115 |
tgaaaaggctctggttttgtgcattgtttgggttctggctttggtgggatctgcaaattatcggtaggtttaataataatgttgtaaaaaat---agtat |
30361211 |
T |
|
| Q |
101 |
attatgaaccaccaaaatgaacactttagtaccacgggacagtcggtggtataggggtatggattagcttttggaacccttgttgcttcctcttccaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30361212 |
attatgaaccaccaaaatgaacacttttgtaccacgggatagtcggtggtataggggtatgggttagcctttggaacccttgttgcttcctcttccaatt |
30361311 |
T |
|
| Q |
201 |
atttctgcaaaagttccatgt |
221 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
30361312 |
ctttttgcaaaagttccatgt |
30361332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 19916511 - 19916701
Alignment:
| Q |
1 |
tgaaatggctttggttttgtgcagtgttttggttctggcttt-ggtgggatctgcaaattatcagtagatttaataataatgtcgtaaaaaattgaagta |
99 |
Q |
| |
|
|||||||||| ||||||||||| |||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
19916511 |
tgaaatggctctggttttgtgcggtgtttgggttctggcttttggtgggatctgcaaattatcagtagatttaataataatgtcataaaaaattgaagca |
19916610 |
T |
|
| Q |
100 |
gattatgaaccaccaaaatgaacactttagtaccacgggacagtcggtggtataggggtatggattagcttttggaacccttgttgcttcc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
19916611 |
gattatgaaccaccaaaatgaacactttagtaccacgggatagtcggtggtataggggtataggttagcttttggaacccttgttgcttcc |
19916701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 13 - 214
Target Start/End: Complemental strand, 24465856 - 24465655
Alignment:
| Q |
13 |
ggttttgtgcagtgttttggttctggctttggtgggatctgcaaattatcagtagatttaataataatgtcgtaaaaaattgaagtagattatgaaccac |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24465856 |
ggttttgtgcagtgtttgggttctggctttggtgggatctgcaaattatcagtagatttaataataatgtcgtaaaaaattgaactagattatgaaccac |
24465757 |
T |
|
| Q |
113 |
caaaatgaacactttagtaccacgggacagtcggtggtataggggtatggattagcttttggaacccttgttgcttcctcttccaattatttctgcaaaa |
212 |
Q |
| |
|
|||||| |||||||| |||||||| | |||| ||||| ||||| ||| ||||| ||||||| || || ||||||||||||||||| ||||||||||| |
|
|
| T |
24465756 |
caaaataaacacttttgtaccacgacatagtccgtggtgcaggggattgggttagcctttggaagccgtgctgcttcctcttccaattctttctgcaaaa |
24465657 |
T |
|
| Q |
213 |
gt |
214 |
Q |
| |
|
|| |
|
|
| T |
24465656 |
gt |
24465655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 13 - 200
Target Start/End: Original strand, 24466057 - 24466236
Alignment:
| Q |
13 |
ggttttgtgcagtgttttggttctggctttggtgggatctgcaaattatcagtagatttaataataatgtcgtaaaaaattgaagtagattatgaaccac |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24466057 |
ggttttgtgcagtgtttgggttctggcttt--------ctgcaaattatcaatagatttaataataatgtcgtaaaaaattgaactagattatgaaccac |
24466148 |
T |
|
| Q |
113 |
caaaatgaacactttagtaccacgggacagtcggtggtataggggtatggattagcttttggaacccttgttgcttcctcttccaatt |
200 |
Q |
| |
|
|||||| |||||||| |||||||| || ||||| |||| ||||| ||| ||||| |||||||||| || ||||||||||||||||| |
|
|
| T |
24466149 |
caaaataaacacttttgtaccacgagatagtcgatggtgcaggggattgggttagcctttggaacccgtgctgcttcctcttccaatt |
24466236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University