View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11436_low_61 (Length: 227)

Name: NF11436_low_61
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11436_low_61
NF11436_low_61
[»] chr4 (1 HSPs)
chr4 (15-210)||(53199428-53199624)


Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 210
Target Start/End: Original strand, 53199428 - 53199624
Alignment:
15 cagagattataacgaatctaatcaatcattgagataattgaatcacctcagtttgaatataacgaagaaagtgagatataagaatacatgaaaaattgaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53199428 cagagattataacgaatctaatcaatcattgagataattgaatcacctcagtttgaatataacgaagaaagtgagatataagaatacatgaaaaattgaa 53199527  T
115 gaaaattagagagataaaataa-caagtgatggaagcgtgtgtgttaccttgggaagacgaatcggtagccataactaagaacgagaatgaatgaat 210  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53199528 gaaaattagagagataaaataagcaagtgatggaagcgtgtgtgttaccttgggaagacgaatcggtagccataactaagaacgagaatgaatgaat 53199624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University