View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11436_low_62 (Length: 223)
Name: NF11436_low_62
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11436_low_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 93 - 145
Target Start/End: Original strand, 35673149 - 35673201
Alignment:
| Q |
93 |
ctctcaacttccaccgctgctgatgcactctcccgcctcctccaccgtctccc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35673149 |
ctctcaacttccaccgctgctgatgcactctcccgcctcctccaccgtctccc |
35673201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University