View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11436_low_63 (Length: 218)
Name: NF11436_low_63
Description: NF11436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11436_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 53199451 - 53199259
Alignment:
| Q |
1 |
tgattagattcgttataatctctgttgtgctttataatctcatgtgatttaacgatccagctcttgattaatctctatcatatcatgttttagcattgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
53199451 |
tgattagattcgttataatctctgttgtgctttataatctcatgtgatttaacgat---------gattaatctctatcatatcatgttttagcattgcc |
53199361 |
T |
|
| Q |
101 |
atcggtcatgtacctcatttttctgtagtttcgtggtccgtatgatatcatgatttagcattgtgatttgtgac--atctgatttctatgcggattgatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
53199360 |
atcggtcatgtacctcatttttctgtagtttcgtggtccatatgatatcatgatttagcattgtgatttgtgacatatctgatttctatgtggattgatt |
53199261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University