View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11438_high_29 (Length: 222)
Name: NF11438_high_29
Description: NF11438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11438_high_29 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 13 - 222
Target Start/End: Complemental strand, 38041920 - 38041708
Alignment:
| Q |
13 |
aagtacaatactaggaatagatttatttatttt-ggtatgatcatcgatgttgcgttattgtgttttaagttgatgtgctgtttcttagaattcacgtaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38041920 |
aagtacaatactaggaatagatttatttatttttggtatgatcatcgatgttgcattattgtcttttaagttgatgtgctgtttcttagaattcacgtta |
38041821 |
T |
 |
| Q |
112 |
attaagttgtattaattcaacaagtatat--taatatgaaatgacatgtttaatattgtttatttagtgtgggcctgtggggaccggggaaccagaacac |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38041820 |
attaagttgtattaattcaactagtatatattaatatgaaatgacatgtttaatattgtttatttagtgtgggcctgtggggactggggaaccagaacac |
38041721 |
T |
 |
| Q |
210 |
aaaggttggtccc |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38041720 |
aaaggttggtccc |
38041708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University