View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11438_high_33 (Length: 213)
Name: NF11438_high_33
Description: NF11438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11438_high_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 19 - 203
Target Start/End: Complemental strand, 38042432 - 38042248
Alignment:
| Q |
19 |
attttcgaaggtcaatgcaagagatggtggaagcgcaaccagagttgatgaaggacgtgaagtccaattgggaaaccttacacgagcttcttcttagcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38042432 |
attttcgaaggtcaatgcaagagatggtggaagcgcaaccagagttgatgaaggacgtgaagtccaattgggaaaccttacacgagcttcttcttagcta |
38042333 |
T |
|
| Q |
119 |
tctcgctattaatcccaacaacactcacaagtttattctcgatgctttttctgatcttattgttactcttatgtcctttgcttct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
38042332 |
tctcgctattaatcccaacaacactcacaagtttattctcgatgctttttctgatcttattgttactctcatgtccttttcttct |
38042248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University