View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11438_low_22 (Length: 284)
Name: NF11438_low_22
Description: NF11438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11438_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 267
Target Start/End: Complemental strand, 47028090 - 47027843
Alignment:
| Q |
19 |
taaagagtgtctcaaacttggttttcactaaggtatactcctgctttatgtcttgcaggcttttaaagcacctgaaatgcnnnnnnnnnnnnnncatgta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47028090 |
taaagagtgtctcaaacttggttttcactaaggtatactcctgctttatgtcttgcaggcttttaaagcacctgaaatgcaacaaaaaaaaaa-catgta |
47027992 |
T |
|
| Q |
119 |
tattttttcctatcagaatatgaacattgtattgccaaagagttttcaaaacatacagaaaattagacatgatattttgaagcttacccttctatgtttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47027991 |
tattttttcctatcagaatatgaacattgtattgccaaagagttttcaaaacataaagaaaattagacatgatattttgaagcttacccttctatgtttt |
47027892 |
T |
|
| Q |
219 |
tctcctcacagtagtttttgaaggcaatacagactctctgaactctctg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47027891 |
tctcctcacagtagtttttgaaggcaatacagactctctgaactctctg |
47027843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University